We use cookies to give you the best experience possible. By continuing we’ll assume you’re on board with our cookie policy

See Pricing

What's Your Topic?

Hire a Professional Writer Now

The input space is limited by 250 symbols

What's Your Deadline?

Choose 3 Hours or More.
Back
2/4 steps

How Many Pages?

Back
3/4 steps

Sign Up and See Pricing

"You must agree to out terms of services and privacy policy"
Back
Get Offer

Structure And Function Relationship Of Processing Alpha Glucosidase Biology

Hire a Professional Writer Now

The input space is limited by 250 symbols

Deadline:2 days left
"You must agree to out terms of services and privacy policy"
Write my paper

Attachment of the saccharide concatenation to protein is one of the most important posttranslational alterations of eucaryotic proteins, particularly secreted and membrane proteins, which lead to the formation of a host of protein-bound oligosaccharides with diverse biological maps. There are 5 distinguishable types of sugar-peptide bonds i.e. N- and O-glycosylated, P-mannosylated, phophoglycation and glypiation ( Spiro 2002 ) . The N- glycosidic bond between the glycan concatenation and Asn residue in the consensus motive ( Asn-X-Ser/Thr ) of a protein is most prevailing among all the types of sugar-amino acid/peptide bonds ( Spiro, 1973 ) .

There are more than 16 enzymes involved in assorted stairss of glycosylation that occur in endoplasmic Reticulum ( ER ) , golgi setup, cytosol and karyon. One of such enzymes is treating alpha glucosidase-I ( glu-I ) , an ER inner membrane bound protein. I±-Glucosidase I commences paring of N-glycans by spliting the I±- ( 1,2 ) linked glucose unit from the freshly assembled Glc3Man9GlcNAc2 after en axis transportation to the nascent sequence ( Asn-X-Thr/Ser ) of proteins ( Grinna & A ; Robbins 1980 ) .

Don't use plagiarized sources. Get Your Custom Essay on
Structure And Function Relationship Of Processing Alpha Glucosidase Biology
Just from $13,9/Page
Get custom paper

It has become apparent that the alterations that take topographic point in the ER reflect a spectrum of maps related to glycoprotein folding, quality control, screening, debasement, and secernment. In the ER, the Glu-I along with alpha-glucosidase-II dramas a major function in protein quality control system. Hence any damage in this tract leads to drastic effects on map of the secreted glycoprotein every bit good as the physiology of the being. The deficiency of glu-I in worlds leads to CDG-IIb [ CDG – congenital upsets of glycosylation ] ( De Praeter et Al. 2000 ) . Despite its critical function in the synthesis of glycoproteins, many facets of construction, catalytic mechanism of glu-I are still unknown.

In Saccharomyces cerevisiae, CWH41 cistron encodes glucosidase-I

Baker ‘s barm, Saccharomyces cerevisiae, a often used eucaryotic theoretical account being, merely possesses two sorts of protein glycosylation, N-glycosylation of asparagine residues and O-mannosylation of threonine and serine residues ( Lehle et al. 2006 ) . These two types of glycosylation are greatly conserved from barm to human. Furthermore, inborn upsets of glycosylation are associated with these two types of glycosylation. Hence, in the current survey, baker ‘s barm will be used as the theoretical account being to analyze the catalytic mechanism and structure-function relationship of glu-I.

In S.cerevisiae, glu-I is encoded by CWH41 cistron ( Romero et al. 1997 ) . It catalyses the remotion of distal I±-1,2 glucose residues from Glc3Man9GlcNAc2 ( G3M9GNA2 ) concatenation co-translationally attached to Asn residue in the consensus motif Asn-X-Ser/Thr of a nascent protein ( Kornfeld and Kornfeld 1985 ) . It belongs to glycosyl hydrolases household 63. This enzyme was foremost purified by Bause et Al. ( 1986 ) and reported to be a 95 kDa glycoprotein with optimal pH 6.8. Glu-I along with glucosidase-II

Previous surveies

Based on old surveies Bause et al. 1986, it is apparent that the glu-I is a 94 kDa protein that is bound to inner membrane of ER. The omission of the N-terminal amino acid residues ( 24 residues ) resulted in soluble activity ( Faridmoayer ) . The proteolytic cleavage of glu-I resulted in assorted abbreviated signifiers among which a smallest 37kDa fragment showed highest catalytic activity, 1.9 times higher than that of the whole protein.

There is less information available sing the amino acid residues that play a function in contact action and substrate binding of glu-I. In the old surveies, site directed mutagenesis of glu-I was carried out ( Faridmoayer and Scaman 2007 ) . When E613 and D617 residues were replaced by alanine, glu-I wholly lost its map. This loss of map was either due to loss of active conformation or the loss of catalytic residues.

Hypothesis

Processing I±-glucosidase I or mannosyl-oligosaccharide glucosidase ( EC 3.2.1.106 ) is a type-II membrane edge glycoprotein with 833 aminic acids. The omission of transmembrane part ( 1-24 amino acids at N-terminus ) resulted in soluble, glycosylated, functional glu-I where as omission of N-terminal 34 amino acids lead to the nonglycosylated catalytically active protein. This truncated catalytically active 94 kDa fragment of glu-I may be expressed in any strong procaryotic look systems like pet in E. coli due to the absence of glycosylation, to steer easy purification.

In general, the hydrolysis by glycosidases occurs via two major mechanisms giving rise to either an overall keeping or an inversion of constellation ( Koshland 1953 ) . The glu-I from S.cerevisiae was found to be an inverting glycosidase ( Palcic ) . Understanding the mechanism of glu-I can assist in development of mechanism based drug. The hydrolysis of glycosidic bond by glycosidases takes topographic point through acid- base contact action which requires two amino acids where one serves as a proton giver and the other as a nucleophile ( ref ) . Based on old findings on glu-I ( Faridmoayer and Scaman 2007 ) , we hypothesize that any two of the conserved carboxylic residues ( D601, E613, D617, D602, D670 and E804 ) play a important function in either contact action or substrate binding since these residues lie in catalytic part. However, homology surveies revealed that the carboxylic residues E613 and E804 are the possible catalytic residues.

Based on current apprehension, trypsin hydrolysis of glu-I at places Lys524 and Phe525 releases a 37 kDa fragment which is 1.9 times more active than the whole enzyme. The recombinant look of 37kDa fragment as an single protein in S.cerevisiae did non take to a catalytically active protein. This may be due to the demand of non-catalytic n-terminal sphere for the active conformation/ folding. Based on these surveies on glu-I, we can speculate that the N-terminal sphere of glu-I has two important functions i.e. aid in geting active conformation/folding and regulative map.

We hypothesize that the N-terminal fragment, due to its regulative map, decreases the activity by strictly specific adhering to its natural substrate. The 37 kDa truncated signifier, which is non regulated by N-terminal sphere, may demo relaxed specificity for sugars ( footing or back uping information needed. YGJK may be an illustration for this but homologyaˆ¦.. ) .

We besides hypothesise that N-terminal sphere of glu-I shows lectin-like activity which facilitates specific adhering to glycan concatenation.

Aims

The chief obstruction in analyzing the construction and catalytic mechanism of glu-I is the measure of the active protein. Purification of ER membrane bound glu-I is boring and besides outputs were really low ( ref ) . In order to acquire the big measures of glu-I for farther word picture surveies, the over look of glu-I will be carried out in E.coli since N-glycosylation is non of import for the map of glu-I.

By and large, the mechanism of action of glycosyl hydrolases involves engagement of two carboxylic residues. Based on old findings ( Faridmoayer and Scaman 2007 ) , we hypothesize that any two of the conserved carboxylic residues ( D601, E613, D617, D602, D670 and E804 ) play a important function in either contact action or substrate binding since these residues lie in catalytic part. However, homology surveies revealed that the carboxylic residues E613 and E804 are the possible catalytic residues. Using site directed mutagenesis, aminic acids at these places will be replaced by their aminoalkane signifiers. Further mutagenesis surveies will besides be carried out in order to understand the catalytic mechanism.

The pH and temperature optima and the kinetic parametric quantities ( substrate specificity, kilometer, Vmax, and Ki against inhibitors like deoxynojiromycin ) of the catalytically active discrepancies will besides be carried out.

Functional look of abbreviated signifiers of CWH41 will be carried out for farther apprehension of the functions of assorted spheres.

Three dimensional constructions of eucaryotic glu-I have non yet been reported although they were studied extensively. The surveies to find the three-dimensional construction of glu-I are being carried out at a confederate ‘s research lab. However, readyings will be carried out for crystallographic surveies of C-terminal 37kDa fragment and mutant signifiers of glu-I.

E. coli expresses a protein called ygjK which is homologous to glu-I ( Kurakata et al. 2008 ) . Due to its more relaxed substrate specificity, mutagenesis surveies will besides be carried out on ygjK to understand the of import residues involved in substrate binding and contact action.

Experimental processs

Microorganisms and civilization media

Saccharomyces cerevisiae:

The growing of Saccharomyces cerevisiae AH22 will be carried out in barm minimum medium supplemented with histidine ( 50 Aµg/ml ) at 28°C and 300 revolutions per minute.

Escherichia coli:

The growing of E. coli DH5I± and BL21 strains will be carried out in autoclaved LB medium at 37 °C and 250 revolutions per minute.

Glucosidase check

The glu-I check will be carried out by spectrophotometric method utilizing man-made trisaccharide as a substrate ( Reference unpublished information ) . The man-made trisaccharide, I±-D-Glc- ( 1,2 ) -I±-D-Glc- ( 1,3 ) -I±-D-Glc-COOCH3 will be incubated with the glu-I and the released glucose will be determined by conjugate enzyme assay ( unpublished information ) . D-glucose, therefore formed due to glu-I activity will be oxidized by glucose oxidase to glucuronic acid and H peroxide. The latter merchandise will be used by peroxidase to change over colorless reduced O-dianisidine to the brown oxidised signifier.

Cloning and heterologic look of glu-I and its abbreviated signifiers in E. coli

The cistron encoding the glu-I, cwh41, will be amplified utilizing following primers-

Forward primer: 5’TCCCCCGGGGAAGAATATCAAAAGTTCACGAATGA3 ‘

Rearward primer: 5’CCGCTCGAGTTAGAAGCGTCCAAGGATGTTG3 ‘

Expression of glu-I will be carried out in E.coli utilizing favored 47b ( + ) vector. The amplified cwh41 cistron will be cloned into favored 47b ( + ) between SmaI and XhoI limitation sites and expressed in E.coli BL21 ( DE3 ) or E.coli BL21-codonplus strain. Optimization of initiation degrees and temperature will be carried out for the higher production of glu-I. The recombinant protein will be expressed with 6xHis ticket which facilitates easy purification.

The familial part for abbreviated signifiers of glu-I will besides be amplified utilizing specific primers and will be cloned into favored 47b ( + ) vector and expressed as described above.

Fig.1 Vector map of pET47b ( + ) ( courtesy- www.emdchemicals.com )

Site-directed mutagenesis of glu-I to place catalytic residues

Homology surveies revealed that the carboxylic residues near to C-terminus are the possible catalytic residues. Hence, to find their function in contact action, these carboxylic residues will be replaced with their aminated opposite numbers ( i.e. sterically conserved residues-asparagine and glutamine ) .

The site-directed mutagenesis of glu-I will be carried out utilizing Quik ChangeA® site-directed mutagenesis kit ( Agilent engineerings ) . The mutagenic primers will be designed in order to replace E670 and E804 with their aminated counter parts. The mutant cistrons, therefore obtained will be cloned and expressed in E. coli to analyze their map and conformation. If necessary, farther mutants will besides be carried out in order to understand the catalytic mechanism of glu-I

Biophysical and biochemical word picture of glu-I and its C-terminal 37 kDa fragment ( cwh41t3p ; M526 to F833 )

Biophysical word picture of glu-I and its discrepancies will be carried out utilizing Cadmium spectroscopy. The Cadmium spectra of glu-I and its discrepancies will be utile in understanding secondary construction and its fluctuations due to mutagenesis. Biochemical word picture of glu-I and its discrepancies will be carried out to understand the substrate specificity and other kinetic parametric quantities like kilometer, Vmax, Kcat etc.

Co-expression surveies of n- and c-terminus of glu-I

Co-expression of non catalytic N- terminus ( — — to — — — ) and catalytic C-terminal ( — — to — — — ) spheres of glu-I will be carried out in E.coli to analyze their single belongingss and interactions. These spheres will be expressed as single proteins with 6xHis tickets. These single spheres will be purified utilizing affinity columns ( IMAC for 6xhis ticket ) and will be tested for interaction.

The interaction of these spheres will be determined ab initio with his pulldown technique and so with yeast two-hybrid system.

His pull down to find interaction between n- and c-terminal spheres

The co-immunoprecipitation is normally used to prove whether two protein interact with each other. The n- and c-terminal spheres will be expressed as single proteins. The purified single his labeled N-terminal sphere will be treated with HRV3C peptidase and purified utilizing IMAC affinity chromatography to take its 6xhis ticket. The N-terminal sphere ( without his ticket ) therefore obtained will be incubated with his-tagged C-terminal sphere which is immobilized onto Ni2+ affinity column. The edge protein will be eluted and eluted fractions will be analyzed on SDS-PAGE.

If any interaction is observed between the c-terminal and n-terminal spheres, farther experiments will be carried out to find exact location or part that is responsible for interaction.

Determination of lectin activity of glu-I

N-terminal part may move as a sugar adhering sphere ( lectin like ) and regulates activity of glu-I. The lectin-like activity of glu-I will be determined by utilizing microtiter home bases that are impregnated with assorted glycan ironss.

Structural word picture of discrepancies of glu-I

The construction of glu-I will be determined utilizing crystallography and X-ray diffraction methods which will be carried out at confederate ‘s lab. The crystals will be grown utilizing hanging bead vapour diffusion method. The crystals therefore formed will be used for diffraction and subsequent analysis for the finding of 3D construction.

Cloning and over look of ygjk protein of E. coli and its word picture

Due to loosen up substrate specificity, ygjk protein will be a good theoretical account for analyzing catalytic mechanism. Hence, the over look of ygjk will be carried out in E.coli. Site directed mutagenesis surveies of ygjk will besides be carried out in order to place catalytic residues and the residues that play a function in substrate binding and specificity.

Significance

The biochemical activity of the glu-I is critical for the normal development and map of many beings including worlds ( De Praeter et Al. 2000 ) . Understanding of assorted facets of this enzyme will assist in understanding legion disease provinces that are straight or indirectly associated with its map.

Inhibitors of N-linked glycosylation tract have been extensively tested for antiviral activity since viral membrane proteins are synthesized and modified post-translationally by host machinery. The inhibitors of glu-I reportedly inhibited the reproduction of many viruses, which require to a great extent glycosylated proteins ( which strongly depend on canexin/calreticulin lectin chaperone system ) for their assembly and map, including human immune lack virus [ HIV ] ( Dwek et al. 2002 ) . Understanding the construction and catalytic mechanism of glu-I will significantly assist in developing mechanism- based drugs that are utile in intervention of assorted disease conditions. Presently many glu-I inhibitors likeaˆ¦ . are used as drugs to handle viral infections. Mechanism-based inactivators/drugs provide same possible clinical advantages as antecedently observed with inhibitor based drugs. The dissociation rate for mechanism based drugs, which covalently modify their mark enzyme, is really low or peers to zero whereas interaction of inhibitors with their enzyme opposite numbers is reversible. The mechanism-based drugs rely on chemical science of enzyme active site and extremely selective to aim enzyme which provide ultimate specificity for usage as drugs.

Understanding of glu-I will besides heighten the cognition of N-glycosylation, which is necessary for use of glycan ironss or glycoengineering for heterologic production of assorted medically or commercially of import proteins.

Decision

The processiong I±-glucosidase-I dramas a important function in quality control of protein N-glycosylation. The current survey will heighten the apprehension of glu-I catalytic mechanism and structural penetrations. The site-directed mutagenesis of glu-I will supply more inside informations about the amino acid residues that play a function in contact action. The coexpression surveies will convey more penetration

Cite this Structure And Function Relationship Of Processing Alpha Glucosidase Biology

Structure And Function Relationship Of Processing Alpha Glucosidase Biology. (2017, Jul 10). Retrieved from https://graduateway.com/structure-and-function-relationship-of-processing-alpha-glucosidase-biology-essay/

Show less
  • Use multiple resourses when assembling your essay
  • Get help form professional writers when not sure you can do it yourself
  • Use Plagiarism Checker to double check your essay
  • Do not copy and paste free to download essays
Get plagiarism free essay

Search for essay samples now

Haven't found the Essay You Want?

Get my paper now

For Only $13.90/page